circad | circRNAs associated with diseases

circHECTD1/mmu_circ_0000375
Gene	HECTD1	Organism	Mouse
Genome Locus	chr12:52860205-52862157:-	Build	n/a
Disease	Silicosis	ICD-10	Pneumoconiosis due to other dust containing silica (J62.8)
DBLink	Link to database	PMID	29290828
Experimental Method
Sample Type	RAW264.7 and L929 Cell lines	Comparison	Primary cultures of alveolar macrophages from healthy donors and patients and the RAW264.7 macrophage cell line
Method for Estimation	Quantitative PCR and Microarrays	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward AACTTAGGCGTATTTGGGAGC Reverse ACATAGTCGTCATCCCAGGC	Statistics	Fold Change : Downregulated pvalue : p<0.05
Citation
Zhou, Z, Jiang, R, Yang, X, Guo, H, Fang, S, Zhang, Y, Cheng, Y, Wang, J, Yao, H, Chao, J (2018). circRNA Mediates Silica-Induced Macrophage Activation Via HECTD1/ZC3H12A-Dependent Ubiquitination. Theranostics, 8, 2:575-592.